There are millions of business and technology blogs, and no one has time to read them all. Here is a selection of the very best.

What we're talking
about today:

education innovation math retirement teacher teacher of the year teaching teaching math technology technology in the classroom

Join our community!
Sign up | Login

WHERE AM I? > BLOGS

BLOGS

Sign up for the ConnectEd RSS feed

Measuring Change

Growth depends on change. Take a look at what we’ve done in education to date and what’s coming around the bend.
- posted Feb 10,2010
  Why Do Children Misbehave?
  0 comments
  There are a little less then a dozen common reasons that children misbehave and over the course of this post, we will examine most of them. By understanding the reasons children misbehave we will have greater success in correcting...
- posted Jan 26,2010
  Teachers Without Borders
  0 comments
  OK, imagine this. You are in this big building with lots of rooms with different signs on each door. You come to a room with a sign saying “hammers,” and you go in and this young, enthusiastic guy shows you pictures of lots of...

Policy Matters

There is no shortage of fresh ideas in the education world—and we need them now more than ever.
- posted Feb 11,2010
  Finding the Value in The Flat World and Education
  1 comment
  This week's Presidential budget is further raising attention on pressing education issues such as teacher quality, closing the achievement gap, and ensuring our communities have the systems in place to drive the levels of improvement we...
- posted Jan 12,2010
  Interactive Whiteboards, Uneven Learning
  0 comments
  Too often, we preach technology for technology's sake in education. Not wanting to be the last industry sector to adopt the latest toys or shiny playthings, we rush out to acquire that which we may not understand or appreciate. As a...

Teaching Experience

A look into this unique and vital world that prepares students for a lifetime of learning.
- posted Feb 03,2010
  Teachers Inspire Future Teachers
  0 comments
  What is the impact of a teacher?How far does it extend?How many students do we positively affect?We can’t accurately answer this. Teachers are told we make a difference, and in our hearts we know we change lives. Yet, it’s hard to...
- posted Jan 21,2010
  Sometimes It's Good to Make Students Cry
  0 comments
  I love to make kids cry. OK, I don't really, but I just HAD to write that first sentence. Occasionally, though, I do get a small sense of satisfaction when kids in my class cry. Because it tells me that something has finally mattered...

Technology in the Classroom

The tools are changing, the landscape looks different but the goal of education is still the same.
- posted Feb 02,2010
  Taking Others' Assessments
  0 comments
  So here’s a crazy idea… • Ask teachers in your building to bring a recent quiz or test to the next staff meeting. Make sure their names are on the assessments they bring. • Mix up all of the assessments in a...
- posted Jan 27,2010
  Wikis are the Graphene of Information
  0 comments
  Graphene is a 2-d form of graphite and was only first discovered in 2004"When physicists from the University of Manchester and Institute for Microelectronics Technology in Chernogolovka Russia found a way to isolate individual graphen...

Education’s Cutting Edge
- posted Feb 09,2010
  Fix Boring School, Not Kids Who Are Bored
  0 comments
  When I came across The Best About Me Page You’ll Ever See on my Twitterfeed I expected to see some funky ideas I could use for my own rather dull “About Me” page. Especially since the “About Me” page belongs to Aaron Iba, the now...
- posted Feb 04,2010
  What If Video Games Were Like School?
  0 comments
  I spent last week in Japan as the guest of Sumitomo Corporation to learn about and research the potential for online learning to help the Japanese learn English. One night at dinner, one of my hosts, Chris Campbell, said: If you were to...

Science in the Classroom
- posted Jan 28,2010
  Battling Suspect State Science Standards
  0 comments
  Our (Minnesota) state science standards are being patched up right now, and while they're mostly just fine, one sneaky provision is still on the books."The student will be able to explain how scientific and technological innovations as...
- posted Jan 20,2010
  Grasping life and humanness
  0 comments
  GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTGIf you string the above sequence of DNA bases in a crab, you get a piece of crabbiness.AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACIf you string the above sequence, you get a piece of humanness....

MOST POPULAR BLOGS

Technology in the Classroom

06-29-2009 7 comments
Online Instruction, Resistance and Stupid Faculty
Education’s Cutting Edge

03-10-2009 5 comments
Greeting Students at the Door
Teaching Experience

11-05-2009 3 comments
Teaching with Learning Objectives
Measuring Change

08-04-2009 3 comments
Rigor Mortis in Educational Thought

IDEAS

ARTICLES

FORUMS

WALDEN EVENTS

To learn more about Walden, join an online forum or meet a local representative in your area.

In-Person Education Information Sessions

Register for a location near you

Online Walden Forums
These free, hour-long online seminars give you the opportunity to interact with a panel of speakers as you find out more about the student experience at Walden.

Register today for a forum